Imprinted Gene

Imagine that for a maternally imprinted gene, allele a encodes an inactive version and allele A is the wildtype version. Do you expect the following individuals to exhibit an abnormal phenotype? Why or why not? a) a female of genotype Aa in which the wildtype allele came from her father? b) a male of genotype Aa in which the wildtype allele came from his mother?

Restriction enzyme

The restriction enzyme ECOR I cuts DNA leaving 5' overhangs, Pst I leaves 3' overhangs after cutting DNA and SMA I leaves blunt ends on the fragments it produces.Indicate wheter DNA ligase can join the following pieces of DNA. a) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was also cut with Ecor I . b) a fragment of human DNA that was generated by cutting with Ecor I and a plasmid DNA that was cut with Pst I. c) a fragment of human DNA that was generated by cutting with Sma I and a plasmid DNA that was also cut with Sma I.

Transcripts

Eukaryotes may regulate gene expression at any number of levels. Imagine that transcripts of gene A are found only in the developing liver and transcripts of gene B are found only in the developing eye. List a general type of cis-regulatory sequence difference that could explain the expression difference between the two genes. b) List one possible mechanism by which a gene may give rise to differently sized mature mRNAs in different tissues. c) List 2 ways in which gene expression may be regulated after a mature transcript is produced ( after addition of a 5' cap and poly (A) tail and removal of introns).

Calculate base pairs (Dna fingerprinting)

In exercise 9 of my lab manual which i attached i need someone to take my distances and calculate base pairs and put it on the graph on page 81. Also tell me which suspect matches the crime scene. My distances are Hind II=20mm,23,25,30,38,39, Crime scene=33,35,52, Suspect 1=37,48,50, s2=27,32,35,41,46, s3=30,33,36,50, s4=37,47,56, s5=35,40,48,57,63

PCR

You would like to amplify a stretch of DNA with the following sequence using the polymerase chain reaction: 5' GTGTTTAGTGGGCGGTAACCGTTACGTAGGTAATGCT 3' Assume (unrealisitcally) that you will use 5 nucleotide long primers positioned to amplify the entire sequence. a) What are the sequences of the two primers you would use? b) What enzyme would you use in your reaction?