MITOSIS AND MEIOSIS

I understand that, in a diploid animal cell, during metaphase of mitosis the chromsomes are aligned along the equator of the cell and, during metaphase 1 of meiosis the homologous chromosomes are drawn into pairs and then aligned along the equator of the cell. (i) What is the significance of the different positions of the chromosomes at these stages of mitosis and meiosis, and what does this mean for the type of progeny cells that result?

bacterial mRNA

This sequence of bases is found in a section of bacterial mRNA.The codon shown on the left hand end of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA from your knowledge of base-pairing rules deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. Determine the sequence of amino acids coded for by this mRNA I have done this question I am hoping my answer will match yours. Many thanks

insertion in DNA

SECTION BACTERIAL mRNA AUGUUUGCUGGGGGACAUUCGUGGGCA produced the following template strand from which this mRNA was transcribed TACAAACCACCCCCTGTAAGCACCCGT My questiohn is inserted a T at the begining of the sequence to produce TTACAAACGACCCCCTGTAAGCACCCGT what is the new mRNA sequence corresponding with this altered DNA Deletetion of the 10th base in the DNA sequence TACAAACGACCCCTGTAAGCACCCGT have removed the C what is the new mRNA sequence corresponding with this altered DNA I assume in the 2nd part the sequence starts with a single T could you help me out regards Sandie

Punnett square help with explaining genetic outcomes

Genetic crosses: explain and complete the following scenarios using Punnett Squares. 1.Punnett square for seed color(yellow or green)of Mendel's peas. Show a cross between 2 parents with yellow seeds, both of which are heterozygous. The square will be used to predict how many offspring with green seeds to expect among a population of 1200 offspring. Draw the square and explain the cross.

Punnett Square Explanation and Solving with genetics

2.Punnett square for 2 genes that affect pod shape (inflated or wrinkled) and flower position (on stem or at tip)in garden peas. One gene has alleles for inflated (A) and wrinkled (a) traits, where inflated is dominant. The other gene has alleles for on stem (B) and at tip (b) traits, where on stem is dominant. In a cross between 2 parents, one of which is heterozygous for both genes and the other is homozygous recessive for both genes, the simulation will use the square to predict the ratio of their offspring that would have wrinkled pods AND have flowers on the stem. Draw the aquare and explain the cross.