Mutation and the experimental evolution of fitness

In a lab experiment we examined the evolutionary effects effects of genetic stress: a harmful recessive mutation (nub E and nub X)that was experimentally introduced into a population of flies hundreds of years ago. The goals were to assess the impact of nub on juvenile fitness, the impact of nub on adult fitness and to assess the degree of compensatory evolution in the evolved wingless population. We compared two populations with one another (nub E and nub X) and with a base population for reference. What could be wrong with this experiment? Could other genetic mechanisms played a role in the differentiation of these populations? If so, how could this have been made a better experiment?

Compensetory evolution following a deleterious mutation in Drosphilia Melanogaster

I just finished doing an experiment in my evolutionary genetics class on the compensatory evolution following a deleterious mutation in Drosphilia and the fitness effects of the nub mutation. I need to find three journal articles on these two topics and I am having some difficulty (they have to be full articles). I was wondering if anyone knew of any articles on these topics that will be of use to me for my report.

System Biology BLASTn Protein Network Cellular Signaling Genetics

1. Perform a BLASTn search with the following sequence but only use 30 of the 50 bases. What was your best match? 5' ATGCT CTGGC CACGG CACTT GCGGA TCCCA TGATC TGTGC ACCTG CGATA 3' 3' TACGA CACCG GTGCC GTGAA CGCCT AGGGT ACTAG ACACG TGGAC GCTAT 5' Look to the right at the "E value" and record this number. Comment on the significance of the value. Now submit all 50 bases and compare your results from the search with only 30 bases. Why did the E value change even though the retrieved sequence was identical? 2. Search NCBI's Human Map Viewer using the term "obesity". You will get hits for every locus that has obesity associated with it. How many loci do you see? Are they clustered on the... click for more

DNA mRNA

Consider the role of the coenzyme NAD in glucose oxidation. In the process of glycolysis the formation of pyruvate involves the reduction of the coenzyme NAD to NAD.2H. (a) Which other stages of glucose oxidation produce molecules of the reduced coenzyme, NAD.2H? (b) Explain what happens to NAD.2H produced during glycolysis in: i) an animal cell respiring aerobically ii) an animal cell respiring anaerobically (c) The oxidation of NAD.2H is an energy-releasing process. Name the energy-requiring process it is coupled to and why this is important for the cell.

DNA sequencing

The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA (a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. (b) Determine the sequence of amino acids coded for by this mRNA. (c) From the answer to (b) there will be two amino acids are repeated in the sequence although the condons in the mNRA are all different from each other. Using one of the repeated amino acids in the sequence as an example explain how is this possible. (d) When DNA is replicated, errors in copying may occur, leading to the substit... click for more