DNA Sequencing - The following sequence of bases is found in a section of bacterial mRNA. The codon shown on the left hand side of the sequence is the start codon for this gene. AUGUUUGCUGGGGGACAUUCGUGGGCA (a) Deduce the sequence of bases in the DNA template strand from which this mRNA was transcribed. (b) Determine the sequence of amino acids coded for by this mRNA. (c) From the answe...

electronegatives - State the type of bonding that is present in barium chloride,BaCl2(2 should be subscript- low down , can't do it in this program), giving your reasons in two or three senttences, using arguments based on electronegatives. Also, give an explanation using electron stuctures, of the way in which the type of bonding explains the chemical formula of the compound (a few sentences) ...