Cellular Respiration

Cellular respiration is a process that occurs in many organisms. The rate of cellular respiration can be measured using several different methods. a) design a specific experiment to measure the rate of cellular respiration in an organism of your choice b) construct a graph to report your results and graph the results that you would expect in your experiment c) explain the significance of your results

Biology Concepts

1. Explain the stages of the cell cycle. Relate how carcinogenesis could be related to flaws in the cycle regulation. 2. Structure and function of eukaryotic chromosomes 3. What are homologous chromosomes? What are alleles on homologous chromosomes? 4. Compare & contrast Mitosis to Meiosis 5. Explain the events of mitosis. What it meant by “Crossing Over”? 6. What accounts for the genetic dissimilarity between parent and daughter cell following meiosis? 7. What other events insure genetic variability of the gametes? 8. Explain what occurs when a non disjunction occurs in the formation of the gametes 9. Explain the events of binary fission in bacterial cells 10. DNA... click for more

DNP & Photosynthesis in plants

Dinitrophenol (DNP) is an “uncoupler” that causes membranes to become permeable to H+. Explain what would happen if DNP was added to plants that were carrying out photosynthesis. Would the light and dark reactions still proceed? Include in your answer whether or not O2, glucose, ATP, and NADPH would be produced

Restriction Enzyme HaeIII

How many DNA fragments would be generated and what would be the size of each fragment if the restriction enzyme HaeIII was mixed with the following DNA sequence? 5’ ACCGGCATTACGGCCTTACATGGCCATAGCCGGAACATCGT 3’ 3’ TGGCCGTAATGCCGGAATGTACCGGTATCGGCCTTGTAGCA 5’

Electron Transport Systems (Aerobic Respiration vs. Light Rxns of Photosynthesis)

Compare and contrast the electron transport systems (ETS) utilized in aerobic respiration and the light reactions of photosynthesis. Include a discussion of the inputs and outputs of each ETS and also give examples of specific electron carriers