Discuss the impact of mutation on somatic cells vs germ cells

Discuss the impact of mutation on somatic cells vs germ cells. Which kind of mutation affects the individual and which kind of mutation affects the population? Why

Cell Biology Problem

* 5’- ATGCTATCATTGACCTTGAGTTATTAA –3’ i) Is this a strand of DNA or RNA? How do you know? ii) If DNA, what is the complementary strand? iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be? iv) If this were the noncoding strand of a DNA molecule, what would the mRNA sequence be? v) If DNA and a base were inserted at the beginning of the 5’ end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code!) vi) If DNA and the G were deleted at the asterisk, how would this affect protein synthesis and the resultant protein? (Hint: think about the code!) vii... click for more

How can a harmful trait, such as Huntington’s disease remain in a population?

How can a harmful trait, such as Huntington’s disease remain in a population?

Normal Meiosis vs Meiosis in Down's Syndrome

Can you draw two diagrams for me one of normal meiosis of a cell with 2 chromosomes (each chromosome should be a different color) in humans vs the events in meiosis which cause Downs' Syndrome. Can you label each stage. It is only necessary to show the affected chromosome for the Downs' Syndrome model.

Describe the process of transcription in eukaryotes.

What is involved in going from genomic DNA to messenger RNA (mRNA)? The transciption process involves the concerted action of several proteins called transcription factors which process the DNA in a multi-step process into mRNA.