Determining the reaction direction, initial velocity of reaction and the Haldane relationship in enzyme kinetics.

A reversible reaction described by the chemical equation shown below (equation one) has an equilibrium constant of 10. (S represents substrate, P represents product.) If we have a mixture containing [S]=2x10E-5 M and [P]=3x10E-5M, and we know that KmS=3x10E-5 M, Vmax (forward reaction) =2 micromole /(L min), and Vmax (reverse reaction) = 4 micromole /(L min), answer the following questions. (a) In which direction will the reaction proceed when the appropriate enzyme is added? (b) After addition of enzyme, what will the initial velocity be when the reaction starts toward equilibrium? Equation one: (refer to the attached file for the equation)

Literature review of the conversion of RNA into DNA.

With particular emphasis on the biochemistry, discuss the machinery involved in the transcriptional process.

Determining the pKa of an acid.

For a weak electrolyte that ionizes as: HX --> H+ + X- construct a buffer with a ratio of 5 moles of HX/2.1 moles X-. The reaction is maintained at pH = 8.7. What is the pKa of the acid?

This is an example of how to do an indepth analysis of a research article. This analysis is on mRNA degradation.

Analyze a peer-reviewed journal article having to do with biochemical research into mRNA degradation.

Molecular Biology Homework Help and Solution

Please see the attached file for full problem description. --- 1. Heparin is a polyanion that inhibits RNA transcription in vitro by binding directly to bacterial RNA polymerase (RNAP). If heparin interferes with the ability of the polymerase to bind DNA in a non-specific fashion, what subunit of RNAP is the heparin binding to? 2. The 5’ end of the codon strand of a prokaryote gene is diagramed below. +1 GACATAAACCCTTTGGGTTGACA(N)18GCTATAATGCCTCCAGTGGGA I II III GGAGGTGGAATGGAACCCGAG ... click for more